gentisate degradation I

MetaCyc:PWY-6223

The complete gentisate isomerization route cleaves gentisate to 3-maleylpyruvate, isomerizes this cis intermediate to 3-fumarylpyruvate, and hydrolyzes it to fumarate and pyruvate. Ralstonia sp. U2 NagI, NagL and NagK supply an experimentally supported complete enzyme realization. U2 NagL uses glutathione as a catalytic cofactor. NagK magnesium and manganese annotations are by similarity, not direct U2 metal measurements. The exact U2 enzyme sequences match deposited strain U2 coding sequences despite the broader organism label in current UniProt. The direct maleate-hydrolysis route and upstream aromatic-substrate conversions are outside this pathway boundary. Separately qualified isomerases represent C. glutamicum ATCC 13032 ncgl2918 with mycothiol and Paenibacillus sp. NyZ101 BagL with L-cysteine, cysteinylglycine or glutathione in vitro. These variant proteins and thiols are alternatives, not a requirement that one organism use all cofactors. Cysteine preference in NyZ101 remains a physiological inference. Metal activation and inhibition edges describe the tagged-enzyme assays with their stated concentrations, not demonstrated native metal requirements. The cysteine/cysteinylglycine zwitterions and glutathione anion are explicit chemical normalization; assay protonation was not measured. The NagI recombinant assay retains a reported primer/start-position conflict; its exact expressed N terminus is unresolved.

Pathway type
gentisate degradation
Organism scope

Read the source YAML

Pathway network

42 nodes · 35 asserted directed edges

Arrows show recorded subject → object relationships, not necessarily metabolic flow. Select a node for details or an arrow for evidence. Scroll, zoom or find a node to explore.

Pathway network: gentisate degradation I 42 nodes · 35 asserted directed edges. Every arrow links to its evidence table row; nodes link to their component details. Isolated declared components are retained. MetaCyc:PWY-6223 — has_part → RHEA:18238; One of the three complete native core reactions, from gentisate through the cis/trans isomerization route to fumarate and pyruvate.; Evidence: MetaCyc:PWY-6223, MetaCyc:GENTISATE-12-DIOXYGENASE-RXNhas part CHEBI:58044 — consumes → RHEA:18238; Complete formal substrates side; coefficient 1.; Evidence: RHEA:18238consumes CHEBI:15379 — consumes → RHEA:18238; Complete formal substrates side; coefficient 1.; Evidence: RHEA:18238consumes RHEA:18238 — produces → CHEBI:16727; Complete formal products side; coefficient 1.; Evidence: RHEA:18238produces RHEA:18238 — produces → CHEBI:15378; Complete formal products side; coefficient 1.; Evidence: RHEA:18238produces MetaCyc:PWY-6223 — has_part → RHEA:17394; One of the three complete native core reactions, from gentisate through the cis/trans isomerization route to fumarate and pyruvate.; Evidence: MetaCyc:PWY-6223, MetaCyc:MALEYLPYRUVATE-ISOMERASE-RXNhas part CHEBI:16727 — consumes → RHEA:17394; Complete formal substrates side; coefficient 1.; Evidence: RHEA:17394consumes RHEA:17394 — produces → CHEBI:16854; Complete formal products side; coefficient 1.; Evidence: RHEA:17394produces MetaCyc:PWY-6223 — has_part → RHEA:26169; One of the three complete native core reactions, from gentisate through the cis/trans isomerization route to fumarate and pyruvate.; Evidence: MetaCyc:PWY-6223, MetaCyc:RXN-10445has part CHEBI:16854 — consumes → RHEA:26169; Complete formal substrates side; coefficient 1.; Evidence: RHEA:26169consumes CHEBI:15377 — consumes → RHEA:26169; Complete formal substrates side; coefficient 1.; Evidence: RHEA:26169consumes RHEA:26169 — produces → CHEBI:15378; Complete formal products side; coefficient 1.; Evidence: RHEA:26169produces RHEA:26169 — produces → CHEBI:29806; Complete formal products side; coefficient 1.; Evidence: RHEA:26169produces RHEA:26169 — produces → CHEBI:15361; Complete formal products side; coefficient 1.; Evidence: RHEA:26169produces RHEA:18238 — provides_input_for → RHEA:17394; The complete shared intermediate is CHEBI:16727. This material connection preserves the native reaction ordering.; Evidence: MetaCyc:PWY-6223, MetaCyc:PWY-6223provides input for RHEA:17394 — provides_input_for → RHEA:26169; The complete shared intermediate is CHEBI:16854. This material connection preserves the native reaction ordering.; Evidence: MetaCyc:PWY-6223, MetaCyc:PWY-6223provides input for UniProtKB:O86041 — catalyzes → RHEA:18238; subject experimental construct: NagI expressed from pWWF19-25 in E. coli and assayed in cell extract. The reported forward primer maps to native Met10, although the paper calls the insert a complete reading frame. This source conflict leaves the expressed sequence unresolved; an exact nine-residue deletion is not asserted.; Evidence PMID:11133965: AGC GAATTC ATATGAGTCACGAACTTGGCCG (Materials and Methods, Expression of nagJ, nagI, nagK, nagL, nagM, and nagN, nagI forward primer; PMC94927 extracted line 156); Evidence PMID:11133965: complete reading frame (Results, NagI catalyzes gentisate transformation, first sentence; PMC94927 extracted line 237); Evidence PMID:11133965: Table 1 identifies pWWF19-25 as the nagI PCR fragment inserted into pET5a; Table 2 places the native nagI coding sequence at nucleotides 14136–15203. (Table 1, pWWF19-25 row; Table 2, nagI row); Evidence UniProtKB:O86041: The native 355-residue NagI sequence begins MLDEEERITMSHELGRLEDL and cross-references AF036940/AAD12619.1. The MSHELG segment starts at residue 10. (sequence.value; sequence.length; uniProtKBCrossReferences[database="EMBL",id="AF036940"]); Ralstonia sp. U2 NagI catalytic identity is supported by the reviewed native sequence annotation. The recombinant pWWF19-25 assay is qualified because the reported primer conflicts with the stated complete reading frame; the actual expressed sequence is unresolved.; Evidence: UniProtKB:O86041, RHEA:18238, PMID:11133965catalyzes UniProtKB:O86043 — catalyzes → RHEA:17394; Ralstonia sp. U2 NagL catalysis is supported by the original study; the native ENZRXN records unpurified heterologous-host assays, not a claim that all assayed preparations were purified.; Evidence: UniProtKB:O86043, RHEA:17394, PMID:11133965catalyzes UniProtKB:O86042 — catalyzes → RHEA:26169; Ralstonia sp. U2 NagK catalysis is supported by the original study; the native ENZRXN records unpurified heterologous-host assays, not a claim that all assayed preparations were purified.; Evidence: UniProtKB:O86042, RHEA:26169, PMID:11133965catalyzes UniProtKB:O86043 — has_cofactor → CHEBI:57925; Glutathione is a catalytic cofactor of the U2 isomerase, not a stoichiometric reactant in the net isomerization.; Evidence: UniProtKB:O86043, PMID:11133965has cofactor UniProtKB:O86042 — has_cofactor → CHEBI:18420; The reviewed UniProt entry annotates this metal by similarity (ECO:0000250). It does not establish direct U2 cofactor measurements or simultaneous occupancy with the alternative metal.; Evidence: UniProtKB:O86042has cofactor UniProtKB:O86042 — has_cofactor → CHEBI:29035; The reviewed UniProt entry annotates this metal by similarity (ECO:0000250). It does not establish direct U2 cofactor measurements or simultaneous occupancy with the alternative metal.; Evidence: UniProtKB:O86042has cofactor MetaCyc:G18NG-12642-MONOMER — catalyzes → RHEA:17394; subject experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.; Evidence PMID:16481315: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative. (Table 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626); The tagged ncgl2918 enzyme from the C. glutamicum ATCC 13032 lineage catalyzes maleylpyruvate-to-fumarylpyruvate isomerization with mycothiol. This variant supplies the isomerase step; it is not a claim that this enzyme supplies the other two pathway reactions.; Evidence: PMID:16481315, MetaCyc:ENZRXN-16404catalyzes MetaCyc:G18NG-12642-MONOMER — has_cofactor → CHEBI:16768; subject experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.; Evidence PMID:16481315: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative. (Table 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626); Mycothiol supports the tagged ncgl2918 isomerase. The native database cofactor frame CPD1G-2 and complete chemical structures establish the CHEBI:16768 identity; the protein is distinct from U2 NagL and NyZ101 BagL.; Evidence: MetaCyc:ENZRXN-16404, PMID:16481315has cofactor UniProtKB:H6TG59 — catalyzes → RHEA:17394; subject experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend); Purified tagged NyZ101 BagL isomerizes maleylpyruvate to fumarylpyruvate. Figure 3A used 50 μM substrate, 10 μM L-cysteine and 4.8 μg enzyme in 1 mL of 50 mM Tris-HCl at pH 8.0.; Evidence: PMID:22636771, UniProtKB:H6TG59catalyzes UniProtKB:H6TG59 — has_cofactor → CHEBI:35235; subject experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend); L-cysteine supports tagged BagL in vitro. Thiol kinetics used 100 μM maleylpyruvate. The ChEBI charge state is explicit graph normalization, not an assay measurement of protonation; this does not establish exclusive physiological use.; Evidence: PMID:22636771has cofactor UniProtKB:H6TG59 — has_cofactor → CHEBI:61694; subject experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend); L-cysteinylglycine supports tagged BagL in vitro. Thiol kinetics used 100 μM maleylpyruvate. The ChEBI charge state is explicit graph normalization, not an assay measurement of protonation; this does not establish exclusive physiological use.; Evidence: PMID:22636771has cofactor UniProtKB:H6TG59 — has_cofactor → CHEBI:57925; subject experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend); reduced glutathione supports tagged BagL in vitro. Thiol kinetics used 100 μM maleylpyruvate. The ChEBI charge state is explicit graph normalization, not an assay measurement of protonation; this does not establish exclusive physiological use.; Evidence: PMID:22636771has cofactor CHEBI:49786 — activates → UniProtKB:H6TG59; object experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend); In vitro, 0.2 mM Ni2+ after 15 min at room temperature increased tagged BagL activity by 20% with L-cysteine or 90% with cysteinylglycine. This is an assay perturbation, not established physiological nickel-cofactor dependence.; Evidence: PMID:22636771activates CHEBI:18420 — inhibits → UniProtKB:H6TG59; object experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend); At 0.2 mM, magnesium(2+) inhibited tagged BagL in vitro. The paper reports 20–53% inhibition collectively across Mg2+, Ca2+, Cu2+ and Zn2+, without assigning an exact percentage to each ion. This is an assay effect.; Evidence: PMID:22636771inhibits CHEBI:29108 — inhibits → UniProtKB:H6TG59; object experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend); At 0.2 mM, calcium(2+) inhibited tagged BagL in vitro. The paper reports 20–53% inhibition collectively across Mg2+, Ca2+, Cu2+ and Zn2+, without assigning an exact percentage to each ion. This is an assay effect.; Evidence: PMID:22636771inhibits CHEBI:29036 — inhibits → UniProtKB:H6TG59; object experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend); At 0.2 mM, copper(2+) inhibited tagged BagL in vitro. The paper reports 20–53% inhibition collectively across Mg2+, Ca2+, Cu2+ and Zn2+, without assigning an exact percentage to each ion. This is an assay effect.; Evidence: PMID:22636771inhibits CHEBI:29105 — inhibits → UniProtKB:H6TG59; object experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend); At 0.2 mM, zinc(2+) inhibited tagged BagL in vitro. The paper reports 20–53% inhibition collectively across Mg2+, Ca2+, Cu2+ and Zn2+, without assigning an exact percentage to each ion. This is an assay effect.; Evidence: PMID:22636771inhibits CHEBI:29105 — activates → MetaCyc:G18NG-12642-MONOMER; object experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.; Evidence PMID:16481315: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative. (Table 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626); In vitro, 1 mM Zn2+ gave 121% relative activity of tagged ncgl2918 after 15 min at room temperature in 20 mM Tris-HCl, pH 8.0. This descriptive assay effect does not establish physiological zinc dependence or statistical significance.; Evidence: PMID:16481315activates CHEBI:29034 — inhibits → MetaCyc:G18NG-12642-MONOMER; object experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.; Evidence PMID:16481315: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative. (Table 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626); In vitro, 1 mM Fe3+ left 85% activity of tagged ncgl2918 after 15 min at room temperature in 20 mM Tris-HCl, pH 8.0. This descriptive assay effect does not establish physiological iron dependence or statistical significance.; Evidence: PMID:16481315inhibits 2,5-dihydroxybenzoate; CHEBI:58044; Declared type: small_molecule small molecule 2,5-dihydroxybenzoate 3-maleylpyruvate(2-); CHEBI:16727; Declared type: small_molecule small molecule 3-maleylpyruvate(2-) 3-fumarylpyruvate(2-); CHEBI:16854; Declared type: small_molecule small molecule 3-fumarylpyruvate(2-) fumarate(2-); CHEBI:29806; Declared type: small_molecule small molecule fumarate(2-) pyruvate; CHEBI:15361; Declared type: small_molecule small molecule pyruvate dioxygen; CHEBI:15379; Declared type: small_molecule small molecule dioxygen hydron; CHEBI:15378; Declared type: small_molecule small molecule hydron water; CHEBI:15377; Declared type: small_molecule small molecule water Gentisate 1,2-dioxygenase; UniProtKB:O86041; Declared type: protein protein Gentisate 1,2-dioxygenase Maleylpyruvate isomerase; UniProtKB:O86043; Declared type: protein protein Maleylpyruvate isomerase Fumarylpyruvate hydrolase; UniProtKB:O86042; Declared type: protein protein Fumarylpyruvate hydrolase glutathionate(1-); CHEBI:57925; Declared type: cofactor cofactor glutathionate(1-) magnesium(2+); CHEBI:18420; Declared type: cofactor cofactor magnesium(2+) manganese(2+); CHEBI:29035; Declared type: cofactor cofactor manganese(2+) mycothiol-dependent maleylpyruvate isomerase; MetaCyc:G18NG-12642-MONOMER; Declared type: protein protein mycothiol-dependent maleylpyruvate isomerase Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein protein Cysteine dependent- maleylpyruvate isomerase mycothiol; CHEBI:16768; Declared type: cofactor cofactor mycothiol L-cysteine zwitterion; CHEBI:35235; Declared type: cofactor cofactor L-cysteine zwitterion L-cysteinylglycine zwitterion; CHEBI:61694; Declared type: cofactor cofactor L-cysteinylglycine zwitterion nickel(2+); CHEBI:49786; Declared type: small_molecule small molecule nickel(2+) calcium(2+); CHEBI:29108; Declared type: small_molecule small molecule calcium(2+) copper(2+); CHEBI:29036; Declared type: small_molecule small molecule copper(2+) zinc(2+); CHEBI:29105; Declared type: small_molecule small molecule zinc(2+) iron(3+); CHEBI:29034; Declared type: small_molecule small molecule iron(3+) 2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+); RHEA:18238; Declared type: molecular_activity; Source reaction direction: left_to_right molecular activity 2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+) 3-maleylpyruvate => 3-fumarylpyruvate; RHEA:17394; Declared type: molecular_activity; Source reaction direction: left_to_right molecular activity 3-maleylpyruvate => 3-fumarylpyruvate 3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+); RHEA:26169; Declared type: molecular_activity; Source reaction direction: left_to_right molecular activity 3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+) gentisate degradation I; MetaCyc:PWY-6223; Declared type: pathway pathway gentisate degradation I Gentisate 1,2-dioxygenase; UniProtKB:O86041; Declared type: protein; experimental construct: NagI expressed from pWWF19-25 in E. coli and assayed in cell extract. The reported forward primer maps to native Met10, although the paper calls the insert a complete reading frame. This source conflict leaves the expressed sequence unresolved; an exact nine-residue deletion is not asserted.; Evidence PMID:11133965: AGC GAATTC ATATGAGTCACGAACTTGGCCG (Materials and Methods, Expression of nagJ, nagI, nagK, nagL, nagM, and nagN, nagI forward primer; PMC94927 extracted line 156); Evidence PMID:11133965: complete reading frame (Results, NagI catalyzes gentisate transformation, first sentence; PMC94927 extracted line 237); Evidence PMID:11133965: Table 1 identifies pWWF19-25 as the nagI PCR fragment inserted into pET5a; Table 2 places the native nagI coding sequence at nucleotides 14136–15203. (Table 1, pWWF19-25 row; Table 2, nagI row); Evidence UniProtKB:O86041: The native 355-residue NagI sequence begins MLDEEERITMSHELGRLEDL and cross-references AF036940/AAD12619.1. The MSHELG segment starts at residue 10. (sequence.value; sequence.length; uniProtKBCrossReferences[database="EMBL",id="AF036940"]) experimental construct Gentisate 1,2-dioxygenase [experimental construct: NagI expressed from pWWF19-25 in E. coli and assayed in cell extract. The reported forward primer…] mycothiol-dependent maleylpyruvate isomerase; MetaCyc:G18NG-12642-MONOMER; Declared type: protein; experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.; Evidence PMID:16481315: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative. (Table 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626) experimental construct mycothiol-dependent maleylpyruvate isomerase [experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from…] mycothiol-dependent maleylpyruvate isomerase; MetaCyc:G18NG-12642-MONOMER; Declared type: protein; experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.; Evidence PMID:16481315: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative. (Table 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626) experimental construct mycothiol-dependent maleylpyruvate isomerase [experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from…] Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein; experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend) experimental construct Cysteine dependent- maleylpyruvate isomerase [experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3),…] Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein; experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend) experimental construct Cysteine dependent- maleylpyruvate isomerase [experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3),…] Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein; experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend) experimental construct Cysteine dependent- maleylpyruvate isomerase [experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3),…] Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein; experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend) experimental construct Cysteine dependent- maleylpyruvate isomerase [experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3),…] Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein; experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend) experimental construct Cysteine dependent- maleylpyruvate isomerase [experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3),…] Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein; experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend) experimental construct Cysteine dependent- maleylpyruvate isomerase [experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3),…] Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein; experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend) experimental construct Cysteine dependent- maleylpyruvate isomerase [experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3),…] Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein; experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend) experimental construct Cysteine dependent- maleylpyruvate isomerase [experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3),…] Cysteine dependent-maleylpyruvate isomerase; UniProtKB:H6TG59; Declared type: protein; experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.; Evidence PMID:22636771: N-terminal His_{6}-tagged (Materials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196); Evidence PMID:22636771: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL. (Table 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend) experimental construct Cysteine dependent- maleylpyruvate isomerase [experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3),…] mycothiol-dependent maleylpyruvate isomerase; MetaCyc:G18NG-12642-MONOMER; Declared type: protein; experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.; Evidence PMID:16481315: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative. (Table 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626) experimental construct mycothiol-dependent maleylpyruvate isomerase [experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from…] mycothiol-dependent maleylpyruvate isomerase; MetaCyc:G18NG-12642-MONOMER; Declared type: protein; experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.; Evidence PMID:16481315: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative. (Table 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626) experimental construct mycothiol-dependent maleylpyruvate isomerase [experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from…]

Components and activities

Declared biological components and source reaction directions
NodeKind or roleSource direction
Ralstonia sp. U2
NCBITaxon:70356		taxon
Corynebacterium glutamicum ATCC 13032
NCBITaxon:196627		taxon
Paenibacillus sp. NyZ101
NCBITaxon:980079		taxon
2,5-dihydroxybenzoate
CHEBI:58044		small molecule
3-maleylpyruvate(2-)
CHEBI:16727		small molecule
3-fumarylpyruvate(2-)
CHEBI:16854		small molecule
fumarate(2-)
CHEBI:29806		small molecule
pyruvate
CHEBI:15361		small molecule
dioxygen
CHEBI:15379		small molecule
hydron
CHEBI:15378		small molecule
water
CHEBI:15377		small molecule
Gentisate 1,2-dioxygenase
UniProtKB:O86041		protein
Maleylpyruvate isomerase
UniProtKB:O86043		protein
Fumarylpyruvate hydrolase
UniProtKB:O86042		protein
glutathionate(1-)
CHEBI:57925		cofactor
magnesium(2+)
CHEBI:18420		cofactor
manganese(2+)
CHEBI:29035		cofactor
mycothiol-dependent maleylpyruvate isomerase
MetaCyc:G18NG-12642-MONOMER		protein
Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59		protein
mycothiol
CHEBI:16768		cofactor
L-cysteine zwitterion
CHEBI:35235		cofactor
L-cysteinylglycine zwitterion
CHEBI:61694		cofactor
nickel(2+)
CHEBI:49786		small molecule
calcium(2+)
CHEBI:29108		small molecule
copper(2+)
CHEBI:29036		small molecule
zinc(2+)
CHEBI:29105		small molecule
iron(3+)
CHEBI:29034		small molecule
2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+)
RHEA:18238		molecular activityleft to right
3-maleylpyruvate => 3-fumarylpyruvate
RHEA:17394		molecular activityleft to right
3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+)
RHEA:26169		molecular activityleft to right

Mechanistic edges

Mechanistic edges and their cited evidence
SubjectPredicate and descriptionObjectEvidence
MetaCyc:PWY-6223has_part

One of the three complete native core reactions, from gentisate through the cis/trans isomerization route to fumarate and pyruvate.

2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+)
RHEA:18238
  • MetaCyc:PWY-6223

    Source assertion: The native reaction-list contains GENTISATE-12-DIOXYGENASE-RXN.

    Source location/ptools-xml/Pathway[@frameid='PWY-6223']/reaction-list/Reaction[@frameid='GENTISATE-12-DIOXYGENASE-RXN']
  • MetaCyc:GENTISATE-12-DIOXYGENASE-RXN

    Source assertion: The native reaction has a RHEA unification cross-reference to 18238; complete compounds, coefficients and selected pathway direction agree.

    Source location/ptools-xml/Reaction/dblink[dblink-db='RHEA']; left; right; reaction-direction
2,5-dihydroxybenzoate
CHEBI:58044		consumes

Complete formal substrates side; coefficient 1.

2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+)
RHEA:18238
  • RHEA:18238

    Source assertion: RHEA:18238 places CHEBI:58044 on its substrates side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/18238 rh:substrates http://rdf.rhea-db.org/18237_L -> http://rdf.rhea-db.org/18237_L rh:contains1 http://rdf.rhea-db.org/Participant_18237_compound_1372 -> http://rdf.rhea-db.org/Participant_18237_compound_1372 rh:compound http://rdf.rhea-db.org/Compound_1372 -> http://rdf.rhea-db.org/Compound_1372 rh:chebi http://purl.obolibrary.org/obo/CHEBI_58044
dioxygen
CHEBI:15379		consumes

Complete formal substrates side; coefficient 1.

2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+)
RHEA:18238
  • RHEA:18238

    Source assertion: RHEA:18238 places CHEBI:15379 on its substrates side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/18238 rh:substrates http://rdf.rhea-db.org/18237_L -> http://rdf.rhea-db.org/18237_L rh:contains1 http://rdf.rhea-db.org/Participant_18237_compound_1198 -> http://rdf.rhea-db.org/Participant_18237_compound_1198 rh:compound http://rdf.rhea-db.org/Compound_1198 -> http://rdf.rhea-db.org/Compound_1198 rh:chebi http://purl.obolibrary.org/obo/CHEBI_15379
2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+)
RHEA:18238		produces

Complete formal products side; coefficient 1.

3-maleylpyruvate(2-)
CHEBI:16727
  • RHEA:18238

    Source assertion: RHEA:18238 places CHEBI:16727 on its products side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/18238 rh:products http://rdf.rhea-db.org/18237_R -> http://rdf.rhea-db.org/18237_R rh:contains1 http://rdf.rhea-db.org/Participant_18237_compound_1248 -> http://rdf.rhea-db.org/Participant_18237_compound_1248 rh:compound http://rdf.rhea-db.org/Compound_1248 -> http://rdf.rhea-db.org/Compound_1248 rh:chebi http://purl.obolibrary.org/obo/CHEBI_16727
2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+)
RHEA:18238		produces

Complete formal products side; coefficient 1.

hydron
CHEBI:15378
  • RHEA:18238

    Source assertion: RHEA:18238 places CHEBI:15378 on its products side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/18238 rh:products http://rdf.rhea-db.org/18237_R -> http://rdf.rhea-db.org/18237_R rh:contains1 http://rdf.rhea-db.org/Participant_18237_compound_3249 -> http://rdf.rhea-db.org/Participant_18237_compound_3249 rh:compound http://rdf.rhea-db.org/Compound_3249 -> http://rdf.rhea-db.org/Compound_3249 rh:chebi http://purl.obolibrary.org/obo/CHEBI_15378
MetaCyc:PWY-6223has_part

One of the three complete native core reactions, from gentisate through the cis/trans isomerization route to fumarate and pyruvate.

3-maleylpyruvate => 3-fumarylpyruvate
RHEA:17394
  • MetaCyc:PWY-6223

    Source assertion: The native reaction-list contains MALEYLPYRUVATE-ISOMERASE-RXN.

    Source location/ptools-xml/Pathway[@frameid='PWY-6223']/reaction-list/Reaction[@frameid='MALEYLPYRUVATE-ISOMERASE-RXN']
  • MetaCyc:MALEYLPYRUVATE-ISOMERASE-RXN

    Source assertion: The native reaction has a RHEA unification cross-reference to 17394; complete compounds, coefficients and selected pathway direction agree.

    Source location/ptools-xml/Reaction/dblink[dblink-db='RHEA']; left; right; reaction-direction
3-maleylpyruvate(2-)
CHEBI:16727		consumes

Complete formal substrates side; coefficient 1.

3-maleylpyruvate => 3-fumarylpyruvate
RHEA:17394
  • RHEA:17394

    Source assertion: RHEA:17394 places CHEBI:16727 on its substrates side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/17394 rh:substrates http://rdf.rhea-db.org/17393_L -> http://rdf.rhea-db.org/17393_L rh:contains1 http://rdf.rhea-db.org/Participant_17393_compound_1248 -> http://rdf.rhea-db.org/Participant_17393_compound_1248 rh:compound http://rdf.rhea-db.org/Compound_1248 -> http://rdf.rhea-db.org/Compound_1248 rh:chebi http://purl.obolibrary.org/obo/CHEBI_16727
3-maleylpyruvate => 3-fumarylpyruvate
RHEA:17394		produces

Complete formal products side; coefficient 1.

3-fumarylpyruvate(2-)
CHEBI:16854
  • RHEA:17394

    Source assertion: RHEA:17394 places CHEBI:16854 on its products side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/17394 rh:products http://rdf.rhea-db.org/17393_R -> http://rdf.rhea-db.org/17393_R rh:contains1 http://rdf.rhea-db.org/Participant_17393_compound_5214 -> http://rdf.rhea-db.org/Participant_17393_compound_5214 rh:compound http://rdf.rhea-db.org/Compound_5214 -> http://rdf.rhea-db.org/Compound_5214 rh:chebi http://purl.obolibrary.org/obo/CHEBI_16854
MetaCyc:PWY-6223has_part

One of the three complete native core reactions, from gentisate through the cis/trans isomerization route to fumarate and pyruvate.

3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+)
RHEA:26169
  • MetaCyc:PWY-6223

    Source assertion: The native reaction-list contains RXN-10445.

    Source location/ptools-xml/Pathway[@frameid='PWY-6223']/reaction-list/Reaction[@frameid='RXN-10445']
  • MetaCyc:RXN-10445

    Source assertion: The native reaction has a RHEA unification cross-reference to 26169; complete compounds, coefficients and selected pathway direction agree.

    Source location/ptools-xml/Reaction/dblink[dblink-db='RHEA']; left; right; reaction-direction
3-fumarylpyruvate(2-)
CHEBI:16854		consumes

Complete formal substrates side; coefficient 1.

3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+)
RHEA:26169
  • RHEA:26169

    Source assertion: RHEA:26169 places CHEBI:16854 on its substrates side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/26169 rh:substrates http://rdf.rhea-db.org/26168_L -> http://rdf.rhea-db.org/26168_L rh:contains1 http://rdf.rhea-db.org/Participant_26168_compound_5214 -> http://rdf.rhea-db.org/Participant_26168_compound_5214 rh:compound http://rdf.rhea-db.org/Compound_5214 -> http://rdf.rhea-db.org/Compound_5214 rh:chebi http://purl.obolibrary.org/obo/CHEBI_16854
water
CHEBI:15377		consumes

Complete formal substrates side; coefficient 1.

3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+)
RHEA:26169
  • RHEA:26169

    Source assertion: RHEA:26169 places CHEBI:15377 on its substrates side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/26169 rh:substrates http://rdf.rhea-db.org/26168_L -> http://rdf.rhea-db.org/26168_L rh:contains1 http://rdf.rhea-db.org/Participant_26168_compound_1283 -> http://rdf.rhea-db.org/Participant_26168_compound_1283 rh:compound http://rdf.rhea-db.org/Compound_1283 -> http://rdf.rhea-db.org/Compound_1283 rh:chebi http://purl.obolibrary.org/obo/CHEBI_15377
3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+)
RHEA:26169		produces

Complete formal products side; coefficient 1.

hydron
CHEBI:15378
  • RHEA:26169

    Source assertion: RHEA:26169 places CHEBI:15378 on its products side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/26169 rh:products http://rdf.rhea-db.org/26168_R -> http://rdf.rhea-db.org/26168_R rh:contains1 http://rdf.rhea-db.org/Participant_26168_compound_3249 -> http://rdf.rhea-db.org/Participant_26168_compound_3249 rh:compound http://rdf.rhea-db.org/Compound_3249 -> http://rdf.rhea-db.org/Compound_3249 rh:chebi http://purl.obolibrary.org/obo/CHEBI_15378
3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+)
RHEA:26169		produces

Complete formal products side; coefficient 1.

fumarate(2-)
CHEBI:29806
  • RHEA:26169

    Source assertion: RHEA:26169 places CHEBI:29806 on its products side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/26169 rh:products http://rdf.rhea-db.org/26168_R -> http://rdf.rhea-db.org/26168_R rh:contains1 http://rdf.rhea-db.org/Participant_26168_compound_3031 -> http://rdf.rhea-db.org/Participant_26168_compound_3031 rh:compound http://rdf.rhea-db.org/Compound_3031 -> http://rdf.rhea-db.org/Compound_3031 rh:chebi http://purl.obolibrary.org/obo/CHEBI_29806
3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+)
RHEA:26169		produces

Complete formal products side; coefficient 1.

pyruvate
CHEBI:15361
  • RHEA:26169

    Source assertion: RHEA:26169 places CHEBI:15361 on its products side with coefficient 1.

    Source locationAggregate rdf:Description by rdf:about: http://rdf.rhea-db.org/26169 rh:products http://rdf.rhea-db.org/26168_R -> http://rdf.rhea-db.org/26168_R rh:contains1 http://rdf.rhea-db.org/Participant_26168_compound_3719 -> http://rdf.rhea-db.org/Participant_26168_compound_3719 rh:compound http://rdf.rhea-db.org/Compound_3719 -> http://rdf.rhea-db.org/Compound_3719 rh:chebi http://purl.obolibrary.org/obo/CHEBI_15361
2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+)
RHEA:18238		provides_input_for

The complete shared intermediate is CHEBI:16727. This material connection preserves the native reaction ordering.

3-maleylpyruvate => 3-fumarylpyruvate
RHEA:17394
  • MetaCyc:PWY-6223

    Source assertion: The native ordering names GENTISATE-12-DIOXYGENASE-RXN as a predecessor of MALEYLPYRUVATE-ISOMERASE-RXN.

    Source location/ptools-xml/Pathway/reaction-ordering[Reaction/@frameid='MALEYLPYRUVATE-ISOMERASE-RXN']/predecessor-reactions/Reaction[@frameid='GENTISATE-12-DIOXYGENASE-RXN']
  • MetaCyc:PWY-6223

    Source assertion: The selected layouts join both reactions through CPD-1070.

    Source location/ptools-xml/Pathway[@frameid='PWY-6223']/reaction-layout[Reaction/@frameid='GENTISATE-12-DIOXYGENASE-RXN']; /ptools-xml/Pathway[@frameid='PWY-6223']/reaction-layout[Reaction/@frameid='MALEYLPYRUVATE-ISOMERASE-RXN']
3-maleylpyruvate => 3-fumarylpyruvate
RHEA:17394		provides_input_for

The complete shared intermediate is CHEBI:16854. This material connection preserves the native reaction ordering.

3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+)
RHEA:26169
  • MetaCyc:PWY-6223

    Source assertion: The native ordering names MALEYLPYRUVATE-ISOMERASE-RXN as a predecessor of RXN-10445.

    Source location/ptools-xml/Pathway/reaction-ordering[Reaction/@frameid='RXN-10445']/predecessor-reactions/Reaction[@frameid='MALEYLPYRUVATE-ISOMERASE-RXN']
  • MetaCyc:PWY-6223

    Source assertion: The selected layouts join both reactions through CPD-277.

    Source location/ptools-xml/Pathway[@frameid='PWY-6223']/reaction-layout[Reaction/@frameid='MALEYLPYRUVATE-ISOMERASE-RXN']; /ptools-xml/Pathway[@frameid='PWY-6223']/reaction-layout[Reaction/@frameid='RXN-10445']
Gentisate 1,2-dioxygenase
UniProtKB:O86041

experimental construct: NagI expressed from pWWF19-25 in E. coli and assayed in cell extract. The reported forward primer maps to native Met10, although the paper calls the insert a complete reading frame. This source conflict leaves the expressed sequence unresolved; an exact nine-residue deletion is not asserted.

Qualification evidence
  • PMID:11133965
    AGC GAATTC ATATGAGTCACGAACTTGGCCG
    Source locationMaterials and Methods, Expression of nagJ, nagI, nagK, nagL, nagM, and nagN, nagI forward primer; PMC94927 extracted line 156
  • PMID:11133965
    complete reading frame
    Source locationResults, NagI catalyzes gentisate transformation, first sentence; PMC94927 extracted line 237
  • PMID:11133965

    Source assertion: Table 1 identifies pWWF19-25 as the nagI PCR fragment inserted into pET5a; Table 2 places the native nagI coding sequence at nucleotides 14136–15203.

    Source locationTable 1, pWWF19-25 row; Table 2, nagI row
  • UniProtKB:O86041

    Source assertion: The native 355-residue NagI sequence begins MLDEEERITMSHELGRLEDL and cross-references AF036940/AAD12619.1. The MSHELG segment starts at residue 10.

    Source locationsequence.value; sequence.length; uniProtKBCrossReferences[database="EMBL",id="AF036940"]
catalyzes

Ralstonia sp. U2 NagI catalytic identity is supported by the reviewed native sequence annotation. The recombinant pWWF19-25 assay is qualified because the reported primer conflicts with the stated complete reading frame; the actual expressed sequence is unresolved.

2,5-dihydroxybenzoate + O2 => 3-maleylpyruvate + H(+)
RHEA:18238
  • UniProtKB:O86041

    Source assertion: The reviewed entry assigns RHEA:18237 catalytic activity to NagI with ECO:0000269 citing PMID:11133965. Its cited genomic sequence is from strain U2.

    Source locationcomments[commentType="CATALYTIC ACTIVITY"].reaction; references[citation.id="11133965"].referenceComments[type="STRAIN"]
  • RHEA:18238

    Source assertion: RHEA:18237 has RHEA:18238 as a directional reaction. The complete substrate/product sides and native pathway layout select its left-to-right physiological orientation.

    Source locationrdf:Description[@rdf:about="http://rdf.rhea-db.org/18237"]/rh:directionalReaction[@rdf:resource="http://rdf.rhea-db.org/18238"]; directional reaction rh:substrates/rh:products; native PWY-6223 reaction-layout
  • PMID:11133965

    Source assertion: Figure 2 records conversion of gentisate to maleylpyruvate by an E. coli cell extract expressing U2 nagI (pWWF19-25), in phosphate buffer at pH 7.4.

    Source locationFigure 2, substrate/product spectra and legend; Figure 6, NagI step
Maleylpyruvate isomerase
UniProtKB:O86043		catalyzes

Ralstonia sp. U2 NagL catalysis is supported by the original study; the native ENZRXN records unpurified heterologous-host assays, not a claim that all assayed preparations were purified.

3-maleylpyruvate => 3-fumarylpyruvate
RHEA:17394
  • UniProtKB:O86043

    Source assertion: The reviewed entry assigns RHEA:17393 catalytic activity to NagL with ECO:0000269 citing PMID:11133965. Its cited genomic sequence is from strain U2.

    Source locationcomments[commentType="CATALYTIC ACTIVITY"].reaction; references[citation.id="11133965"].referenceComments[type="STRAIN"]
  • RHEA:17394

    Source assertion: RHEA:17393 has RHEA:17394 as a directional reaction. The complete substrate/product sides and native pathway layout select its left-to-right physiological orientation.

    Source locationrdf:Description[@rdf:about="http://rdf.rhea-db.org/17393"]/rh:directionalReaction[@rdf:resource="http://rdf.rhea-db.org/17394"]; directional reaction rh:substrates/rh:products; native PWY-6223 reaction-layout
  • PMID:11133965

    Source assertion: Figure 3 records maleylpyruvate-to-fumarylpyruvate conversion with an E. coli extract expressing U2 nagL (pWWF53), with 1 mM reduced glutathione at pH 7.4.

    Source locationFigure 3, substrate/product spectra and legend; Figure 6, NagL step
Fumarylpyruvate hydrolase
UniProtKB:O86042		catalyzes

Ralstonia sp. U2 NagK catalysis is supported by the original study; the native ENZRXN records unpurified heterologous-host assays, not a claim that all assayed preparations were purified.

3-fumarylpyruvate + H2O => fumarate + pyruvate + H(+)
RHEA:26169
  • UniProtKB:O86042

    Source assertion: The reviewed entry assigns RHEA:26168 catalytic activity to NagK with ECO:0000269 citing PMID:11133965. Its cited genomic sequence is from strain U2.

    Source locationcomments[commentType="CATALYTIC ACTIVITY"].reaction; references[citation.id="11133965"].referenceComments[type="STRAIN"]
  • RHEA:26169

    Source assertion: RHEA:26168 has RHEA:26169 as a directional reaction. The complete substrate/product sides and native pathway layout select its left-to-right physiological orientation.

    Source locationrdf:Description[@rdf:about="http://rdf.rhea-db.org/26168"]/rh:directionalReaction[@rdf:resource="http://rdf.rhea-db.org/26169"]; directional reaction rh:substrates/rh:products; native PWY-6223 reaction-layout
  • PMID:11133965

    Source assertion: Figures 4 and 5 record fumarylpyruvate hydrolysis by an E. coli extract expressing U2 nagK (pWWF96); Figure 5 quantifies the fumarate and pyruvate products by HPLC.

    Source locationFigures 4 and 5, reaction spectra and product time course; Figure 6, NagK step
Maleylpyruvate isomerase
UniProtKB:O86043		has_cofactor

Glutathione is a catalytic cofactor of the U2 isomerase, not a stoichiometric reactant in the net isomerization.

glutathionate(1-)
CHEBI:57925
  • UniProtKB:O86043

    Source assertion: The COFACTOR comment identifies glutathione (CHEBI:57925) with ECO:0000269 citing PMID:18824004.

    Source locationcomments[commentType="COFACTOR"].cofactors[cofactorCrossReference.id="CHEBI:57925"]
  • PMID:11133965

    Source assertion: Figure 3 includes reduced glutathione (1 micromole in 1 mL) in the NagL isomerization assay. Figure 6 places GSH at the NagL step.

    Source locationFigure 3, assay legend; Figure 6, GSH at NagL reaction
Fumarylpyruvate hydrolase
UniProtKB:O86042		has_cofactor

The reviewed UniProt entry annotates this metal by similarity (ECO:0000250). It does not establish direct U2 cofactor measurements or simultaneous occupancy with the alternative metal.

magnesium(2+)
CHEBI:18420
  • UniProtKB:O86042

    Source assertion: The COFACTOR comment lists Mg(2+) (CHEBI:18420) with ECO:0000250 (by similarity), without a direct experimental citation.

    Source locationcomments[commentType="COFACTOR"].cofactors[cofactorCrossReference.id="CHEBI:18420"]
Fumarylpyruvate hydrolase
UniProtKB:O86042		has_cofactor

The reviewed UniProt entry annotates this metal by similarity (ECO:0000250). It does not establish direct U2 cofactor measurements or simultaneous occupancy with the alternative metal.

manganese(2+)
CHEBI:29035
  • UniProtKB:O86042

    Source assertion: The COFACTOR comment lists Mn(2+) (CHEBI:29035) with ECO:0000250 (by similarity), without a direct experimental citation.

    Source locationcomments[commentType="COFACTOR"].cofactors[cofactorCrossReference.id="CHEBI:29035"]
mycothiol-dependent maleylpyruvate isomerase
MetaCyc:G18NG-12642-MONOMER

experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.

Qualification evidence
  • PMID:16481315

    Source assertion: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative.

    Source locationTable 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626
catalyzes

The tagged ncgl2918 enzyme from the C. glutamicum ATCC 13032 lineage catalyzes maleylpyruvate-to-fumarylpyruvate isomerization with mycothiol. This variant supplies the isomerase step; it is not a claim that this enzyme supplies the other two pathway reactions.

3-maleylpyruvate => 3-fumarylpyruvate
RHEA:17394
  • PMID:16481315

    Source assertion: The Figure 5 legend identifies panel A as mycothiol-dependent maleylpyruvate-to-fumarylpyruvate isomerization and panel B as absorption changes during catalysis.

    Source locationFigure 5A–B and legend; mycothiol extracted receipt lines 1787–1796
  • MetaCyc:ENZRXN-16404

    Source assertion: The enzyme field identifies G18NG-12642-MONOMER and the reaction field identifies MALEYLPYRUVATE-ISOMERASE-RXN; evidence is a purified-protein assay in a heterologous host, citing PMID16481315.

    Source locationEnzymatic-Reaction[@frameid="ENZRXN-16404"]/enzyme; /reaction; /evidence
mycothiol-dependent maleylpyruvate isomerase
MetaCyc:G18NG-12642-MONOMER

experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.

Qualification evidence
  • PMID:16481315

    Source assertion: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative.

    Source locationTable 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626
has_cofactor

Mycothiol supports the tagged ncgl2918 isomerase. The native database cofactor frame CPD1G-2 and complete chemical structures establish the CHEBI:16768 identity; the protein is distinct from U2 NagL and NyZ101 BagL.

mycothiol
CHEBI:16768
  • MetaCyc:ENZRXN-16404

    Source assertion: The cofactor field identifies mycothiol (CPD1G-2) for G18NG-12642-MONOMER and cites PMID16481315.

    Source locationEnzymatic-Reaction[@frameid="ENZRXN-16404"]/cofactor/Compound[@frameid="CPD1G-2"]; cofactor/citation
  • PMID:16481315

    Source assertion: The Figure 5 legend identifies the assayed reaction as mycothiol-dependent isomerization of maleylpyruvate to fumarylpyruvate.

    Source locationFigure 5A–B legend
Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59

experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.

Qualification evidence
  • PMID:22636771
    N-terminal His_{6}-tagged
    Source locationMaterials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196
  • PMID:22636771

    Source assertion: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL.

    Source locationTable 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend
catalyzes

Purified tagged NyZ101 BagL isomerizes maleylpyruvate to fumarylpyruvate. Figure 3A used 50 μM substrate, 10 μM L-cysteine and 4.8 μg enzyme in 1 mL of 50 mM Tris-HCl at pH 8.0.

3-maleylpyruvate => 3-fumarylpyruvate
RHEA:17394
  • PMID:22636771

    Source assertion: Figure 3A records the maleylpyruvate-to-fumarylpyruvate spectral conversion catalyzed by H6-BagL in the presence of L-cysteine.

    Source locationFigure 3A, spectra and legend
  • UniProtKB:H6TG59

    Source assertion: The entry assigns bagL to Paenibacillus sp. NyZ101 (taxon 980079) and links its 162-residue sequence to genomic accession HQ897158 and protein ADZ54051.1.

    Source locationprimaryAccession; organism; genes; sequence; uniProtKBCrossReferences[database="EMBL"]
Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59

experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.

Qualification evidence
  • PMID:22636771
    N-terminal His_{6}-tagged
    Source locationMaterials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196
  • PMID:22636771

    Source assertion: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL.

    Source locationTable 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend
has_cofactor

L-cysteine supports tagged BagL in vitro. Thiol kinetics used 100 μM maleylpyruvate. The ChEBI charge state is explicit graph normalization, not an assay measurement of protonation; this does not establish exclusive physiological use.

L-cysteine zwitterion
CHEBI:35235
  • PMID:22636771

    Source assertion: Table 2 reports BagL kinetics with L-cysteine: Km 15.4 ± 2.1 μM and kcat 4,286 ± 142 min−1 (mean ± SD).

    Source locationTable 2, Cysteine row and footnote
Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59

experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.

Qualification evidence
  • PMID:22636771
    N-terminal His_{6}-tagged
    Source locationMaterials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196
  • PMID:22636771

    Source assertion: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL.

    Source locationTable 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend
has_cofactor

L-cysteinylglycine supports tagged BagL in vitro. Thiol kinetics used 100 μM maleylpyruvate. The ChEBI charge state is explicit graph normalization, not an assay measurement of protonation; this does not establish exclusive physiological use.

L-cysteinylglycine zwitterion
CHEBI:61694
  • PMID:22636771

    Source assertion: Table 2 reports BagL kinetics with L-cysteinylglycine: Km 8.4 ± 1.3 μM and kcat 4,489 ± 163 min−1 (mean ± SD).

    Source locationTable 2, Cysteinyl glycine row and footnote
Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59

experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.

Qualification evidence
  • PMID:22636771
    N-terminal His_{6}-tagged
    Source locationMaterials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196
  • PMID:22636771

    Source assertion: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL.

    Source locationTable 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend
has_cofactor

reduced glutathione supports tagged BagL in vitro. Thiol kinetics used 100 μM maleylpyruvate. The ChEBI charge state is explicit graph normalization, not an assay measurement of protonation; this does not establish exclusive physiological use.

glutathionate(1-)
CHEBI:57925
  • PMID:22636771

    Source assertion: Table 2 reports BagL kinetics with reduced glutathione: Km 552 ± 78 μM and kcat 6,129 ± 309 min−1 (mean ± SD).

    Source locationTable 2, GSH row and footnote
nickel(2+)
CHEBI:49786		activates

In vitro, 0.2 mM Ni2+ after 15 min at room temperature increased tagged BagL activity by 20% with L-cysteine or 90% with cysteinylglycine. This is an assay perturbation, not established physiological nickel-cofactor dependence.

Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59

experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.

Qualification evidence
  • PMID:22636771
    N-terminal His_{6}-tagged
    Source locationMaterials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196
  • PMID:22636771

    Source assertion: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL.

    Source locationTable 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend
  • PMID:22636771
    increased
    Source locationResults, Biochemical properties of BagL, metal-ion paragraph; extracted line 229
magnesium(2+)
CHEBI:18420		inhibits

At 0.2 mM, magnesium(2+) inhibited tagged BagL in vitro. The paper reports 20–53% inhibition collectively across Mg2+, Ca2+, Cu2+ and Zn2+, without assigning an exact percentage to each ion. This is an assay effect.

Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59

experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.

Qualification evidence
  • PMID:22636771
    N-terminal His_{6}-tagged
    Source locationMaterials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196
  • PMID:22636771

    Source assertion: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL.

    Source locationTable 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend
  • PMID:22636771
    inhibited
    Source locationResults, Biochemical properties of BagL, metal-ion paragraph listing Mg2+, Ca2+, Cu2+ and Zn2+; extracted line 229
calcium(2+)
CHEBI:29108		inhibits

At 0.2 mM, calcium(2+) inhibited tagged BagL in vitro. The paper reports 20–53% inhibition collectively across Mg2+, Ca2+, Cu2+ and Zn2+, without assigning an exact percentage to each ion. This is an assay effect.

Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59

experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.

Qualification evidence
  • PMID:22636771
    N-terminal His_{6}-tagged
    Source locationMaterials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196
  • PMID:22636771

    Source assertion: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL.

    Source locationTable 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend
  • PMID:22636771
    inhibited
    Source locationResults, Biochemical properties of BagL, metal-ion paragraph listing Mg2+, Ca2+, Cu2+ and Zn2+; extracted line 229
copper(2+)
CHEBI:29036		inhibits

At 0.2 mM, copper(2+) inhibited tagged BagL in vitro. The paper reports 20–53% inhibition collectively across Mg2+, Ca2+, Cu2+ and Zn2+, without assigning an exact percentage to each ion. This is an assay effect.

Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59

experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.

Qualification evidence
  • PMID:22636771
    N-terminal His_{6}-tagged
    Source locationMaterials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196
  • PMID:22636771

    Source assertion: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL.

    Source locationTable 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend
  • PMID:22636771
    inhibited
    Source locationResults, Biochemical properties of BagL, metal-ion paragraph listing Mg2+, Ca2+, Cu2+ and Zn2+; extracted line 229
zinc(2+)
CHEBI:29105		inhibits

At 0.2 mM, zinc(2+) inhibited tagged BagL in vitro. The paper reports 20–53% inhibition collectively across Mg2+, Ca2+, Cu2+ and Zn2+, without assigning an exact percentage to each ion. This is an assay effect.

Cysteine dependent-maleylpyruvate isomerase
UniProtKB:H6TG59

experimental construct: NyZ101 BagL assayed as an N-terminal His6 fusion expressed from pZWT51/pET28a in E. coli BL21(DE3), then Ni-NTA purified and dialyzed. The exact full tag extension was not established.

Qualification evidence
  • PMID:22636771
    N-terminal His_{6}-tagged
    Source locationMaterials and Methods, Cloning and expression of bag genes; Results, Overexpression and purification of BagL; extracted lines 149–156 and 196
  • PMID:22636771

    Source assertion: Table 1 identifies pZWT51 as the bagL NdeI–EcoRI insert in pET28a and lists E. coli BL21(DE3). Figure 3 identifies the assayed enzyme as H6-BagL.

    Source locationTable 1, E. coli BL21(DE3), pET-28a and pZWT51 rows; Figure 3A legend
  • PMID:22636771
    inhibited
    Source locationResults, Biochemical properties of BagL, metal-ion paragraph listing Mg2+, Ca2+, Cu2+ and Zn2+; extracted line 229
zinc(2+)
CHEBI:29105		activates

In vitro, 1 mM Zn2+ gave 121% relative activity of tagged ncgl2918 after 15 min at room temperature in 20 mM Tris-HCl, pH 8.0. This descriptive assay effect does not establish physiological zinc dependence or statistical significance.

mycothiol-dependent maleylpyruvate isomerase
MetaCyc:G18NG-12642-MONOMER

experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.

Qualification evidence
  • PMID:16481315

    Source assertion: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative.

    Source locationTable 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626
  • PMID:16481315
    stimulation of activity to 121%.
    Source locationResults, effects of metal ions and chemicals on enzyme activity; extracted lines 1727–1735; Methods, metal preincubation conditions
iron(3+)
CHEBI:29034		inhibits

In vitro, 1 mM Fe3+ left 85% activity of tagged ncgl2918 after 15 min at room temperature in 20 mM Tris-HCl, pH 8.0. This descriptive assay effect does not establish physiological iron dependence or statistical significance.

mycothiol-dependent maleylpyruvate isomerase
MetaCyc:G18NG-12642-MONOMER

experimental construct: C. glutamicum ncgl2918 assayed as an N-terminal hexahistidine fusion expressed from pET28a-ncgl2918. The exact full tag extension was not established; the later structural deposit tag is not assigned to this assay.

Qualification evidence
  • PMID:16481315

    Source assertion: Table 1 identifies pET28a as an expression vector with an N-terminal hexahistidine tag and pET28a-ncgl2918 as its ncgl2918 expression derivative.

    Source locationTable 1, pET28a and pET28a-ncgl2918 rows; extracted lines 624–626
  • PMID:16481315
    inhibition with a residual activity of 85%.
    Source locationResults, effects of metal ions and chemicals on enzyme activity; extracted lines 1721–1727; Methods, metal preincubation conditions

References

Curation history